Départ français Connectez-vous ou inscrirez-vous sur HDYO Enfants Adolescents Jeunes adultes Parents MHJ Amis Professionnels Nouveautés A propos de nous Vidéos Livres Recherche MH Evénements Posez votre question Soutien local HDYO service aux jeunes Liens Nous contacter Conditions Protection des données Langue Plan du site Faites un don Boutique

Le gène de la maladie de Huntington : Sous le microscope

June 22, 2015

Huntington's Disease Youth Organization

HDYO met sur son site plus d'informations à la dispoisition de jeunes, parents et professionnels.


Le gène de la maladie de Huntington : Sous le microscope

La maladie de Huntington est causée par une expansion dans un gène spécifique, dans l’ADN d’une personne. Cet article examinera le gène en question et se penchera sur cette ‘expansion’. Nous utiliserons également des arbres généalogiques pour vous montrer comment le gène est hérité et se transmet.

Gènes, Chromosomes et ADN

DNA, chromosomes and genes

Tout d’abord, revoyons nos bases, commençant par l’ADN. C’est le nom donné à la substance chimique primordiale de la formation de nos gènes. Les lettres ‘ADN’ sont les initiales pour Acide Désoxyribonucléique (accrocheur, n’est-ce pas ?). Pas étonnant, que personne n’utilise vraiment le nom complet – ADN est bien plus facile à dire et à retenir.

L’ADN est ce que nous héritons de nos parents, eux-mêmes l’ayant hérité de leurs parents et ainsi de suite. Notre ADN définit qui nous sommes, ce à quoi nous ressemblons et comment nous grandissons. Des choses comme la couleur de nos cheveux, de nos yeux, notre taille, si nous sommes homme ou femme, ainsi que certains aspects de notre personnalité sont toutes inscrites dans notre ADN.

‘ADN’ est le nom de la substance chimique, tandis que les gènes sont, ce que l’on appelle, les ‘instructions’ inscrites dans l’ADN. Nous avons beaucoup de gènes – aux alentours de 23.000 gènes, pour être plus précis, dans chaque cellule de notre corps. Chaque gène est une liste d’instructions – un peu comme une recette. Un gène dicte à la cellule comment produire une substance chimique appelée une protéine. Les protéines sont les machines qui font toutes les choses importantes dans nos cellules, comme générer des réactions chimiques ou transmettre des messages d’une cellule à une autre.

Les gènes sont liés les uns aux autres comme des saucisses et emballés dans ce que l’on appelle des chromosomes. Il y a 46 chromosomes au total. 23 chromosomes proviennent d’un parent et 23 proviennent de l’autre. Chaque cellule de notre corps contient une copie des 46 chromosomes.

Changements génétiques : le gène de la maladie de Huntington

Les bases sont maintenant revues, alors jetons un œil sur le gène Huntington. Parfois, des changements (appelés ‘mutations’ par les chercheurs) ont lieu au sein même des chromosomes ou des gènes. Ces changements peuvent perturber le fonctionnement de notre corps et causer des maladies génétiques. Le moindre changement dans le gène peut altérer considérablement la protéine. Imaginez une recette stipulant de cuire une tarte 400 minutes au lieu de 40 et vous verrez comment une petite faute de frappe dans nos gènes peut causer d’énormes problèmes.

EN 1993, UNE EQUIPE DE CHERCHEURS DECOUVRIT LE GENE responsable de la maladie de Huntington, situé sur le chromosome 4. Ils observèrent qu’une partie de ce gène se répétait, encore et encore, comme un bégayement ou comme lorsque l’on presse trop longtemps une touche du claaaaaaaaaaaaaaaaaaaaaavier. Cette répétition est la cause du développement de la maladie de Huntington et est appelée la ‘répétition CAG’.

Qu’est-ce qu’une ‘répétition CAG’ ?

CAG repeats

Si vous vous demandez pourquoi le bégayement du gène Huntington est appelé la ‘répétition CAG’, et bien, c’est comme pour l’ADN : c’est l’abréviation de mots scientifiques compliqués. Fondamentalement, l’ADN est formée à partir de quatre bases, dénommées Adénine ( A ), Cytosine ( C ), Guanine ( G ) et Thymine ( T ). Ces bases représentent le code de notre ADN et de nos gènes. Chaque gène possède un code différent, et les scientifiques étant paresseux, ils préfèrent écrire de simples lettres au lieu de mots compliqués. Donc, les quatre bases de l’ADN sont connues comme étant A, C, G et T, et si quelqu’un se prenait d’envie d’écrire un code génétique quelconque, cela donnerait quelque chose comme ceci : AAGTCCTGACTGGGACCTTGAGA CCTAG.

Si un gène est comme une recette, alors les bases sont comme les lettres de l’alphabet qui forment les instructions de la recette. Et même si les gènes utilisent un alphabet très simple composé de seulement quatre lettres, l’orthographe n’en reste pas moins tout aussi importante.

Le gène responsable de la maladie de Huntington contient une section où les bases C, A et G se répètent sans cesse – ‘la répétition CAG’. La plupart des copies du gène contiennent entre 10 et 20 répétitions, mais parfois, le nombre de répétitions s’accroit et c’est là que les problèmes commencent.

Répétitions CAG

Tout le monde possède deux copies du gène de la maladie de Huntington, qu’ils soient à risque ou non. Une copie étant héritée de chaque parent. Et chaque gène de la maladie de Huntington contient une répétition CAG.

Ce qui cause le développement de la maladie est le nombre de répétitions CAG. En bref, les personnes qui développent la maladie de Huntington ont une ‘répétition CAG’ plus longue que ceux qui ne l’ont pas. De façon à rendre les choses plus claires, nous allons diviser les répétitions CAG en quatre catégories. Il suffit d’une copie plus longue pour que les problèmes se manifestent.

26 ou moins (Inoffensif)

Comme déjà mentionné, tout le monde possède une répétition CAG dans leurs gènes Huntington (même ceux qui n’ont pas la maladie dans leur famille). La plupart des gens n’ayant pas la maladie de Huntington ont autour de 10 à 20 répétitions. En fait, tant que vous ne dépassez pas les 26 répétions de CAG, tout va bien, vous n’êtes pas en danger. Mais, une fois ce nombre dépassé, il peut y avoir certaines complications.

40 répétitions ou plus (Zone de maladie)

Toute personne possédant 40 répétions CAG ou plus est, malheureusement, certaine de développer la maladie, tôt ou tard, avec un risque de transmission de 50% à chacun de leurs enfants. La plupart des gens atteints de la maladie de Huntington ont entre 40 à 5O répétitions CAG.

Le nombre de répétitions intermédiaire, de 27 à 39, sont plutôt rares. Ils sont un peu moins simples. En fait, les scientifiques ne les comprennent pas encore complètement. Ils sont parfois désignés comme étant la ‘zone grise’.

27-35 ‘répétitions’ (Risque pour les générations futures)

La bonne nouvelle est que les personnes se situant dans ce niveau de répétition ne développeront pas la maladie. Cependant, un risque existe (autour de 5%) que les enfants d’une telle personne contracte la maladie, car ce niveau de répétition, une fois transmis à l’enfant, peut augmenter, passant ainsi dans un niveau de développement de la maladie.

36-39 répétitions (Pénétration réduite)

Les personnes se situant dans ce niveau de répétition pourraient ou ne pourraient jamais développer la maladie de Huntington. Elles pourraient également développer la maladie très tard. Tellement tard, qu’elles pourraient mourir de vieillesse avant même de développer des symptômes. Cependant, le risque de transmission aux enfants est toujours de 50%. Les scientifiques désignent cette incertitude par la ‘pénétration réduite’.

*Fait: Les répétitions CAG sont ce que les scientifiques comptent lorsqu’une personne passe un TEST GÉNÉTIQUE pour la maladie de Huntington.

Hériter le gène Huntington ‘allongé’

Principe de base : si le gène Huntington contient trop de répétitions CAG, il génère la maladie de Huntington. Voyons maintenant comment les gens héritent ce gène allongé et comment la maladie de Huntington se transmet de génération en génération.

Le risque de 50%

50% risk

Les personnes atteintes de la maladie de Huntington ont hérité le gène allongé de l’un des deux parents. Puisque l’on hérite une copie de chaque chromosome de chaque parent, nous avons deux copies de chaque gène – une venant de maman et l’autre venant de papa.

Donc, une personne atteinte de la maladie de Huntington possède deux copies du gène Huntington, l’un des deux étant allongé (par de nombreuses répétitions CAG) et l’autre étant tout à fait normal.

Une personne dépourvue de la maladie de Huntington possède, elle aussi, deux copies du gène Huntington. Mais leurs deux gènes sont normaux.

Donc un enfant dont l’un des deux parents est atteint de la maladie de Huntington hérite un gène normal du parent non affecté, mais pourrait tout aussi bien avoir hérité un gène normal qu’un gène allongé du parent malade.

C’est pourquoi le risque d’hériter le gène allongé est de 50%.

Techniquement, quatre résultats possibles se présentent en regard de la transmission de la maladie (ainsi que l’illustration le démontre). Dans deux de ces cas, l’enfant est atteint de la maladie de Huntington, tandis que cela n’est pas le cas dans les deux autres situations – les risques sont donc bien de 50%. Pour un peu simplifier la situation, il vous suffit d’écarter le parent qui n’a pas la maladie de Huntington, et de vous concentrer uniquement sur les chances qu'a l’enfant d’hériter le gène allongé du parent atteint de la maladie. Dans tous les cas, le risque reste bien de 50%.

Qu’un enfant hérite le gène allongé ou non est entièrement lié au hasard, raison pour laquelle les gens tendent à comparer les risques de transmission de la maladie de Huntington à un jeu de pile ou face. Chaque individu possède ses propres 50% de chance, comme si chacun avait sa propre pièce à lancer avec ses propres risques en jeu.

Les 25% de probabilité

25% grandchild risk

Pour certains cependant, le risque n’est pas aussi évident que ces 50%. En effet, si l’un des grands-parents d’un enfant a la maladie de Huntington, mais que le parent de l’enfant potentiellement atteint n’a pas été testé, dans ce cas, les risques pour l’enfant d’hériter la maladie de Huntington sont de 25%.

Car nous ne savons pas si le parent possède le gène allongé ou non. S’il s’avérait que le parent a le gène allongé, alors les risques pour l’enfant passeraient à 50%.

Dans le cas où le parent n’a pas le gène allongé, alors les risques passent de 25% à 0% - il n’y a donc aucun risque pour l’enfant. Tout dépend des gènes dont le parent a hérité. Tant que cela n’est pas confirmé, les risques pour l’enfant sont de 25%.

Dominance autosomique

Vous pourriez vous demander : ‘Mais si quelqu’un possède un gène allongé et un gène normal, pourquoi donc est-ce le gène allongé qui prend le dessus et cause la maladie de Huntington ? Pourquoi donc le gène normal ne se défend-t-il pas ?’ Et bien, à cela, la réponse est : ‘dominance autosomique’. Malheureusement, la maladie de Huntington est ce que l’on appelle une ‘maladie autosomique dominante’, ce qui signifie que bien qu’une seule des deux copies du gène ne soit allongée, celle-ci suffit pour provoquer la maladie. En d’autres mots : ce gène malade domine le gène normal. C’est pourquoi il suffit d’un gène allongé pour générer la maladie, et non deux.

Synthèse : Dans cette section, nous avons mis en évidence que le gène qui cause la maladie de Huntington est allongé, puisqu’il contient trop de ‘répétitions CAG’, et que l’on peut classer ces répétitions CAG’ en quatre catégories. Nous avons ensuite observé les risques d’hériter de la maladie de Huntington et comment cela fonctionne. Et malgré certains mots compliqués comme ‘dominance autosomique’, nous espérons avoir clarifié les choses plutôt que de les embrouiller davantage. Si, malgré tout, vous avez toujours des questions, n’hésitez pas à vous rendre à la section POSER UNE QUESTION, où des experts seront prêts à vous répondre. Il vous est également possible de CONTACTER HDYO directement, si vous désirez poser vos questions en privé.